<First>
Sl.NO Accession NO SSR Type SSR Start End Length 1 CN601383 trinucleotide TCCTCCTCCTCATCCTCATCCTCCTC 106 131 26 2 CN601579 trinucleotide TGCTGCTGCCGCTGCTGCTGCT 192 213 22 3 CN599796 trinucleotide TGCTGCTGCCGCTGCTGCTGCT 45 66 22 4 CN599974 trinucleotide TTATTATTATTATTATTATTATT 184 206 23 5
<prev>	<First>

The Computational analysis of Oil Palm EST - SSR by SSR PRIMER (Robinson et al . 2004)

SSR type Total Percentage Dimer 15 31.81% Trimer 25 56.81% Tetramer 3 6.81% Pentamer 2 4.54% Total number of sequences analyzed: 2413 Total number of SSRs found in sequences: 44 The SSR 'CAG' has repeated 6 times (13.63%)of the total SSR.